BASIC GENETICS
Note: Answers given here should not be construed as providing medical advice. Answers may vary with the specific case, the specific family, and the specific circumstances.
TABLE OF CONTENTS
1. sex determination / 2. inbreeding / 3. blood type / 4. man-woman genetic differences / 5. what is a gene? / 6. number of human genes / 7. What is epigenetics? / 8. Are viruses alive? / 9. The two parts of a gene / 10. Sequenced genomes / 11. Brothers' (or sisters') gene differences / 12. Same genes in all the cells of the body? / 13. inheritance of blue eyes / 14. Discovering baby's sex in advance / 15. Mother's genes passed on
Scroll down to a numbered question and click on it to find its answer.
1. Who determines the sex of the baby, the mother or the father? Answer: The father determines the gender of the baby. This is because the baby’s gender is determined by whether it receives a Y chromosome or not, and it is only the father who has a Y chromosome to give.
Women have two X chromosomes (XX sex-chromosome constitution), while men have one X and one Y chromosome (XY sex-chromosome constitution). When a man produces sperm cells, half of them carry an X chromosome and half carry a Y. When a Y-bearing sperm fertilizes an X-bearing egg, the embryo is XY, and develops into a male. If an X-bearing sperm fertilizes the egg, the embryo is XX, and develops into a female. 15.viii.15
2. If I marry my cousin and we have kids, what are the chances that they will have genetic defects? – Answer: The background necessary to answer this question is this: Everyone carries a few defective genes, but most of the time just one bad copy of each. The other copy of that gene, received at conception from a different parent, is usually a good copy. For many genes, one good copy is enough for normal function, so often there will be no noticeable effect of the presence of a bad gene copy.
You and a first cousin have two grandparents in common. If you marry that cousin, and either of those grandparents happened to be carrying a bad copy of a given gene, there is an increased chance that both you and your cousin will end up carrying that bad copy. Then you might both unknowingly pass the bad copy on to your child – who would then start life with two bad copies and no good copy of that gene at all. How that might happen is shown in the diagram below, where a is the bad gene copy passed down from one grandparent, and the double horizontal line indicates the first-cousin marriage.)
But good and bad copies of a gene, if present, get passed from one generation to the next at random. So maybe a bad gene copy in a grandparent won’t get handed down; or maybe only one cousin will receive it; or if both cousins have it, maybe they won’t both pass it on to their child. So there is only an increased risk of some bad gene ending up in two copies in the child. Besides, some bad gene copies have only mild effects.
The “normal” risk of a genetic disease or congenital defect of some kind in a child of two unrelated people is about 1%. If the two people are first cousins, the risk is increased to about 2-5%. 12.v.14
3. Could the blood type of my dead grandparents be determined? – Answer: “Blood type” (A, B, AB, or O) usually refers to the “ABO system,” determined by different forms of the ABO gene. Sometimes included is the “+” or “–” (positive or negative), referring to the presence or absence of a different chemical substance determined by a different gene, the RH gene.
The most direct way to determine the blood type of your deceased grandparents would be to recover enough DNA from their remains to analyze the ABO and RH genes themselves, and see what forms of these genes they had. Sometimes this is technically possible, even for remains many decades old. Success depends critically on the conditions of burial, and the method of DNA extraction. This is an area that is still being actively investigated.
In some families ordinary pedigree analysis of the grandparents’ living descendants – including information about one’s own blood type and that of parents, siblings, aunts, uncles, and cousins – could provide enough information to allow a good guess about what the grandparental blood types might have been.
18.vi.14
4. Are there genetic differences between men and women? Answer: Yes. The various kinds of difference add up to a 5-10% difference overall—enough to support the idea that there are innate differences between men and women beyond the purely reproductive functions, although we still don’t know much about which trait-differences are innate and which ones are a result of socialization. Some details of what we do know are given below.
SEX CHROMOSOMES
The most obvious difference, which can be seen with an ordinary microscope, is in the sex chromosomes (see Figure, sex chromosomes circled). There are really two differences: (1) a woman has two X chromosomes, a man has only one; and (2) a man has a Y chromosome, a woman doesn’t.
The X chromosome has over a thousand genes in it, most of which have nothing to do with the anatomical differences between men and women—genes for blood clotting, for color vision, for immune system activity, for enzymes and other proteins involved in basic cell functions, and many others. Nevertheless, there are two consequences of having two X chromosomes (women) versus only one X chromosome (men). First, a woman’s cells are making twice as much of some substances encoded in X-chromosome genes. These substances are enzymes, structural proteins, and regulatory proteins, involved in the functioning of various kinds of cells in the body. How the differences in the amounts of these proteins might cause some of the differences between women and men is not known.
Second, if there’s a bad gene in a woman’s X chromosome, she has another X which usually carries a compensating good gene; so she usually suffers no ill effects. But a man has only one X, and only single copies of all the X-chromosome genes. He is stuck with them, be they good or bad. He has no second good copy of a gene that could compensate for a bad copy. Some examples of bad X-chromosome genes are those causing muscular dystrophy, retinitis pigmentosa, hemophilia, and some kinds of genetic immunodeficiency, deafness, and mental disease. Men therefore suffer these genetic conditions more often than women do. Also, the cumulative effects of a few not-so-good genes carried by men’s single X-chromosome may be part of the reason that men, on average, don’t live as long as women.
As for the Y chromosome, it is small and has relatively few genes in it. But the genes it does have are required for male embryonic development, including the formation of the testis and its sperm cells. Females, lacking a Y chromosome, don’t have these genes. One important Y-chromosome gene, the SRY gene, is used in some of the brain cells of males, and so might contribute to brain differences between men and women.
OTHER CHROMOSOMES
Starting at about 7 weeks after conception, many genes in the twenty-two other chromosomes (other than the sex chromosomes, and therefore the same in both sexes) are used differently in the two sexes. Besides the various genes for reproductive anatomy and reproductive function (active in one sex and suppressed in the other), there are many other genes not directly related to sex that are nevertheless used differently in the two sexes. Examples of traits influenced by these genes are height, locations of fat deposition, muscle development, and small differences in the size of specific regions of the brain. These male-female differences are the result of the two sexes using their genes differently, often because of hormone differences.
SUMMARY
About 1000-2000 genes (5-10% of all genes) are used at significantly different levels in the two sexes. How these sex-differences in gene usage might be related to male-female differences in general—personality traits, temperament, social behavior, competitiveness, occupational interests, susceptibility to certain specific diseases, memory and other mental functions, and other differences—is only partly understood. Genes are important in male-female differences in susceptibility to multiple sclerosis and rheumatoid arthritis, and perhaps also in map-reading ability. Other male-female differences, such as differences in math-test scores, choice of career, and who does the cooking, are primarily the result of social factors, not genes. The majority of male-female trait differences, such as emotionality, aggression, general sociability, and proneness to alcoholism or depression, are probably the result of both genetic and social factors.
September 25, 2018. Thanks to Jan, Roger, John, Lainie, Diana, Betsy, and Jim for comments & suggestions.
5. What is a gene? – Answer: A simple definition that covers a majority of cases: a gene is a segment of a DNA molecule whose subunit sequence (such as … TATAACCATTGCGCTGGGTTAACG … etc.) is used by a cell in the body to synthesize a protein. (Proteins are the main working molecules of cells and of the body as a whole; they are are large molecules, and the genes that carry the codes for them are correspondingly large, typically consisting of sequences thousands of subunits long, rather than the short sequence just given. The DNA subunits are adenine, guanine, cytosine, and thymine, abbreviated A, G, C, and T.) How does a gene work? Strictly speaking, a gene doesn’t “work” at all; it’s just a piece of chemical information – in the same way that a recipe doesn’t actively “do” anything in the making of a chocolate cake; it is just used (by the chef) to make the cake. Similarly, a gene is used (by a cell) to make a protein.
Shown below is a diagram summarizing what’s going on inside a cell. A gene has two parts, a regulatory region and a coding region. The regulatory region determines whether or not, in this cell, this gene will be used at all, and if so when, and how often; the coding region determines what kind of protein it will be (see also Question 9 below). If the cell has the right kinds of proteins to bind this regulatory region, then the cell will transcribe this coding region, making a copy of it in the form of an RNA molecule, the “working copy” of this gene. Additional biochemical machinery will then translate the RNA sequence into a chain of amino acids, which folds up to become a new functional protein molecule. (The gene, the RNA molecule, and the protein molecule are all much longer than indicated in the diagram.)
An alteration in the DNA sequence of a gene can have an effect, in the same way that an alteration in a cake recipe, that by mistake happens to specify “salt” instead of sugar,” gives an unusable final product. If the sequence of a gene is accidentally altered by a mutation, the resulting protein might not function, the consequence being a genetic disease.
29.xii.15
6. How many genes do humans have? – Answer: There are about 21,000 genes in each cell of the body – a common definition of a “gene” being a sequence of DNA that carries the genetic code for a protein and its close variants. (Proteins are the large molecules that are the main structural and working components of the cells of the body. Different cell types use different subsets of those genes.) The majority of the genes code for enzymes, the proteins that regulate the chemical reactions in the body. Other genes code for structural proteins (such as collagen and keratin), transport proteins (such as hemoglobin and ion-channel proteins), and regulatory proteins (such as DNA-binding proteins and insulin).
If the definition of the word “gene” is broadened to include other DNA sequences that have other important roles to play – serving as binding sites for regulatory proteins, for example, or providing template sequences for important RNA molecules – then the number of “genes” (in this broader sense) is closer to 50,000.
Incidentally, the number of genes in other mammals, from mouse to dog to humpback whale, is about the same as the number in human beings. It takes that many genes to build any of these animals, which after all have the same body plan. (The size difference is just a matter of how many cells are produced by cell divisions in going from a fertilized egg to an adult.)
6.i.16
7. What is epigenetics? – Answer: “Standard genetics” is based on the DNA sequences of genes (their regulatory sequences and their coding sequences), which are predictably passed from parents to offspring, and serve as a chemical code that the different cells of the body translate into the amino-acid chains of their proteins. “Epigenetics” (Greek ἐπι-, epi, “on top of” or “in addition to”), on the other hand, is based on chemical groups (sometimes called “epigenetic marks”) added to genes’ basic DNA sequences. If a standard gene has a DNA sequence …gattgcgcgatgccaagggctctctagctttccatgttc… (the letters a, t, g, and c stand for the four “bases” of subunits of DNA), then the same DNA sequence epigenetically modified might look like …gattgčgčgatgccaagggctctctăgctttccatgttc… where the extra marks represent other chemical groups added to some of the bases (or to proteins closely associated with the DNA), while the basic DNA sequence has not changed.
Genes are like a computer’s routines and subroutines that are automatically brought into play as needed. The cells of the developing embryo and the adult body use their genes as part of the body’s mechanisms of adaptation and survival. Epigenetically modified genes are like certain of the computer’s routines and subroutines that have now become password-protected, and can no longer be automatically used unless the password is removed or reset at some later time. Epigenetic modification of genes is a previously unsuspected way that cells of the body regulate patterns of gene usage. These patterns vary from cell type to cell type in the body, including the cells of the brain. Probably a significant fraction of our 21,000 genes are affected by epigenetic modifications in one cell type or another.
Some epigenetic changes are a regular part of normal embryonic development. Two important cases are: (1) The inactivation of certain genes in developing eggs in the ovary, and of other genes in developing sperm cells in the testis. Now when the embryo is formed at conception by the fusion of egg and sperm, the embryo has, instead of two functional copies, only single working copies of these particular genes. Unlike the two working copies of most other genes, single working copies of these genes is a requirement for normal embryonic development. (2) The inactivation of most of the genes in one of the two X chromosomes of female embryos. This leaves the female embryo with “a single active X.” Male embryos have only one X chromosome anyway, so in this way the usage of many important genes is equalized between the two sexes.
Many other cases of epigenetic gene inactivation are the result of subtle responses of cells to internal or external environmental factors, such as hormones, diet, infections, stress, or other unknown factors. This could be one of the reasons that “identical” twins are not really identical: they are not using all their genes in exactly the same way. (One twin may be autistic, the other not. One twin may grow up with same-sex orientation, the other with opposite-sex orientation. At least, epigenetic gene changes are being considered as a possible explanation for such differences between so-called “identical” twins.) The cause-and-effect pathways leading from the outside to epigenetic modifications of specific genes inside cells have not been worked out, and are still not understood. This is an active area of investigation.
When eggs and sperm are being formed for the embryos of the next generation, most of the epigenetic marks carried in them are removed. This means that the new embryo begins its life with its genetic slate wiped clean. However, sometimes a few of the epigenetic marks acquired by the parents during their lifetime are carried over into the offspring. This may account for occasional “transgenerational epigenetic effects.” In one experiment, mice trained to avoid a specific odor had baby mice that tended to avoid the same odor, even though the basic DNA sequences for odor-detection had not changed. There is evidence that similar epigenetic effects might play a role in human health. Thus parents who early in their lives had experienced unusual stress, were exposed to harmful chemicals, or underwent periods of disease or famine, might have children or even grandchildren who suffer various consequences such as obesity, diabetes, susceptibility to mental disease, or shortened lifespan – not from altered genes per se, but as a result of chemical groups attached to DNA and carried by eggs and sperm into the next generation.
10.ii.16. Thanks to Pamela Dickson for this question.
8. Are viruses alive? – Answer: Yes and no; it depends on what you mean by “alive.” (You sometimes hear the term “live virus,” but this refers only to an undamaged virus that can do its usual thing – not that the virus is necessarily “alive” by the usual criteria for life.)
Cells are alive. The whole biological world, outside of viruses, is made of cells – from bacteria to worms to oak trees to people. Here is what a cell does, in being alive:
(1) A cell copies its thousands of genes, which are made of DNA, the information-carrying nucleic acid molecule the cell uses in making the thousands of different kinds of protein it needs to carry out its life functions.
(2) A cell occasionally copies its DNA imperfectly, giving rise to mutations, the basis for evolutionary change. Therefore cells (and the multicellular organisms that are composed of them) can evolve.
(3) A cell takes in material from the outside, through its surrounding membrane, and, using the information in its genes, transforms that material into more of its own particular kinds of protein.
A virus is not a cell. A virus infects a cell by going inside it, where it reproduces itself. Inside the cell, a virus doesn’t do everything a living cell does, but mainly just (1) copies its genes, and (2) mutates and undergoes evolutionary change. A virus does not do (3), take in material from outside itself and transform it to all the proteins it needs. A virus, to complete its reproduction, relies mostly on the genes and the proteins of the cell it has infected.
So if (1) and (2) are your criteria for life, then a virus is alive. If (3) is also a criterion, then it isn’t. Different people emphasize different features of living things, and so come to different conclusions about whether a virus is alive or not.
Here are some other differences between viruses and cells: (A) - The number of genes in a virus is typically only about one or two dozen, not the thousands that a cell has. Most viruses are really small, much smaller than cells, and don’t have enough genes or proteins to carry on an independent life. (B) - The genes of some viruses are made DNA; the genes of other viruses are made of RNA, a different nucleic acid. Viruses are the only place in the world where genes can be made of RNA rather than DNA. (C) - When a virus reproduces, it doesn’t divide into two the way a cell does. Instead, using the biochemical machinery of the cell it has infected, it makes hundreds or even thousands of copies of itself, all at one go.
Some other interesting facts about viruses: (A) - The existence of viruses was first demonstrated in the 1890s. About 5000 viruses are now known, but there are probably many times that number in nature. (B) - Depending on which virus it is, a virus may kill the cells it infects, or it may not. In either case, viruses can spread throughout the body either from living cells or from killed cells. (C) - Because viruses reproduce inside cells, where they are shielded from outside chemicals, they cannot be neutralized by ordinary antibiotics. But once the viruses are released from the infected cells, they can be neutralized by a vaccine (if available) injected the bloodstream. The body’s own immune system also provides protection against many viral infections (although not all). (D) - Probably every kind of cell on earth is susceptible to infection by one virus or another. There are viruses that infect bacteria, viruses that infect plants, and viruses that infect humans and other animals. (E) - A viruses may cause a disease, or it may not, again depending on the virus. Here are a few of the many viruses that do cause disease in humans: rhinovirus (the virus of the common cold), Zika virus, Ebola virus, human immunodeficiency virus (HIV), human papilloma virus, influenza virus, rabies virus, Herpes virus, polio virus, measles virus. And here are some human viruses that don’t seem to cause any disease: human foamy virus, parvovirus, some strains of arenavirus, some strains of hantavirus. (Harmless viruses might be just as numerous as disease-causing viruses, but they don’t advertise themselves by causing a disease, and so we know less about them.)
How and when did viruses first arise? We don’t know. Viruses might be remnants of pre-cellular life; it’s possible that they originally reproduced on their own, and became intracellular parasites only later, after cells arose. (This idea is supported by the recent discovery of the existence of some very large viruses – bigger than some cells – with more than a thousand genes, giving them a little more independence from the cells they infect.) On the other hand, from the way they reproduce now (inside cells), maybe cells had to come first, and viruses only came later, as parasites of cells. Another “cells-first-viruses-later” possibility is that at some point in the evolution of life, cells started producing viruses as little packages of genes that were released from their original cellular homes, and given a way to distribute themselves more widely – in a sneeze, for example. And maybe, viruses being so different from one another, they arose in all three ways at different times.
Does it really matter whether we call them “living,” or not? They are what they are; their characteristics are fascinating, and their mode of existence makes us think about what the basic features of life are, and what life might have been like at its origin. In the end, those questions are more important than attaching a label to them.
14.iv.16
9. What are the regulatory and the coding parts of a gene? Answer: The diagram illustrating the answer to Question 5 above gives an answer to this question. (It’s in a simplified form there: the regulatory region is longer and may come in several scattered sub-regions; and the coding region is very much longer.) The DNA sequences of the regulatory part of a gene serve as places where special regulatory proteins attach. If these proteins are present in a cell, and they bind the regulatory region, then the rest of the gene can be used by the cell. (If not, then this particular cell does not use this particular gene.)
The gene’s “being used” by a cell means that other biochemical machinery in the cell is transcribing the DNA sequences of the adjacent coding part of the gene; that information is eventually translated into a particular kind of protein molecule.
Therefore the binding of special proteins to a gene’s regulatory region determines whether the gene is to be used or not in that cell, and the gene’s coding region determines what kind of protein can be made from the gene. In short, use of the gene’s regulatory part determines whether it is “on” or “off,” and use of the coding part determines the kind of protein.
Remember the old 78-rpm record-players? Some of the records had, at intervals, wide grooves that separated successive songs on the record. Placing the phonograph needle in a wide groove would determine that the next region of the record would be played, and the following narrow-grooved region would determine what song it was. The record is the DNA; the wide groove is the regulatory region of a gene; the narrow grooves are its coding region.
All the cells of the body have the same record. Some kinds of cell play some of the songs, other cells play others.
November 18, 2016
10. How many organisms have had their genome completely sequenced? – Answer: As of this date (May, 2017), we have complete genome (DNA) sequences of about 17,000 organisms, most of them bacteria. The breakdown according to species-groups is shown in the Table below; the middle column shows the number of whole-genome sequences up to now.
Included in the Table is a typical number of genes for a species in each group. The number of genes in different species within a group may vary. For example, among animals, flies and mosquitos have about 14,000 genes, zebrafish about 23,500, frogs about 28,000, lizards about 15,000, mice about 19,000, the bottlenose dolphin about 24,000, and humans about 22,000 genes.
See https://www.ncbi.nlm.nih.gov/genome/
Thanks to Will Shaw for the question.
May 23, 2017
11. Why are brothers (or sisters) from the same parents genetically different? -- The complete answer to this question has two parts, (1) the mechanism by which the same parents can produce different sets of genes for their different children, and (2) why the mechanism evolved in the first place.
Answer (1), the mechanism. The genes any father has are a combination of those he received from his father (by way of a sperm cell) and those he received from his mother (by way of an egg cell). The same is true for any mother. Because there’s so much variation in genes in general, the two copies of Father’s genes will often be different: for gene A, he might have, say, A1 from his father and A2 from his mother. For this gene his “genotype” would be A1 A2. The same could be true for Mother: for example, for her gene A, she by chance also could have A1 from her father and A2 from her mother; her “genotype” would also be A1 A2.
Father and Mother decide to have a child. In both testis and ovary, a special kind of process called “meiosis” takes place. At the end of the cell-divisions of meiosis, just one copy of each gene has been passed to a sperm cell or an egg cell. Half of Father’s sperm cells will contain A1 and half will contain A2. Similarly, in the example given above, half of Mother’s eggs will contain A1 and half will contain A2. What will the child have? That depends on which sperm meets which egg, and that’s a matter of chance. One possibility is that an A1 sperm meets an A2 egg; then the child’s genotype will be A1 A2.
Father and Mother decide to have a second child, with (obviously) a new sperm and a new egg. This time it might be an A2 sperm and an A2 egg; the second child’s genotype will then be A2 A2.
For this simple example, involving just one gene, the possible genotypes for any one child are A1 A2, A2 A2, or A1 A1. It’s a matter of chance for each pregnancy, so siblings may very well end up with different gene combinations. And when it is remembered that there are thousands of genes that are likely to be different from sperm cell to sperm cell, and egg cell to egg cell, even with the same parents, it is almost certain that two siblings will end up having different gene combinations. It’s all because of the genetically different kinds of sperm cells and egg cells that meiosis produces.
Answer (2), why? The mechanism of meiosis, besides giving a sperm cell or an egg cell with a single set of genes, gives sperm cells and egg cells that are all genetically different. And when sperm cells fuse with egg cells in various combinations, at random, even more genetic diversity results. It may be that over the long course of evolution the offspring of parents who produce genetically diverse offspring are able to survive changing environments better than offspring who are all genetically the same. Meiosis, which occurs in almost all plants and animals, is the mechanism that arose long ago to produce that genetic variety.
March 15, 2018
12. Do all the cells in the body have the same genes? – Answer: This was a question geneticists asked themselves in the early part of the last century. Now, ever since the 1950s, we know the answer. The answer is yes (with a few exceptions).
Here is how this comes about: All the cells of the body come from one single cell, the zygote, which is the cell formed by the fusion of an egg cell and a sperm cell (it therefore has a double set of genes). Within the first day after fertilization, the zygote duplicates all its DNA (containing all the genes), and then divides into two cells. Each of these two cells gets the same DNA (with all the genes) that the zygote had to start with. Then there is another DNA duplication and another cell division, giving four cells; then eight cells, then sixteen . . . and so on, with DNA duplication preceding each cell division. It keeps going like this for the next eighteen or twenty years, until the adult has about 10,000,000,000 cells, all of them with the same DNA sequences, and all of them with the same genes. (Different cell types function differently, although they all possess the same genes, because they use only some of their genes and ignore others.)
Three specialized cell types are exceptions to the general rule that all cells have the same genes:
(1) Red blood cells: During their final maturation, every red blood cell gets rid of its nucleus (where the DNA is located). So the mature red blood cells in the blood stream have no genes at all. (This is true of all mammals.) Unable to divide, these cells have to be replaced continually by division of bone-marrow stem-cells.
(2) Immune-system cells: During their maturation, specialized cells of the immune system (white blood cells and other cells) do some cutting and splicing of their “immunity genes,” giving each individual cell its own unique immunity-gene sequences. For those immunity genes only, each cell is different from every other cell. This produces the variety that allows the body to make billions of antibodies, each one different.
(3) Gametes (egg and sperm cells): During the maturation of egg cells and sperm cells (in the ovary and the Fallopian tube, and in the testis, respectively), a special kind of cell division results in just one set of genes for each egg or sperm cell. (This prepares for a coming fertilization, when the fusion of egg and sperm will restore the double set of genes.) The single set of genes carried by an egg or sperm cell consists of a more-or-less random sampling from the double set of genes that the mother or father has. Therefore, each gamete is different from every other gamete. This produces the variety that allows people worldwide to have billions of children, each one different.
October 2, 2018 Thanks to JWL for the question.
13. How is blue eye-color inherited? (Milena asked: My mother has blue eyes and my father has brown eyes, as does my husband. What are the chances that my baby will have blue eyes? Does our being from Bulgaria make any difference?) – Answer: Remember that lots of babies born with blue eyes commonly have their eye-color change, during their first year or two, to a darker color, close to what their adult eye-color will be. On the other hand, some children’s eyes change only slightly and remain light-colored (blue or greenish or grey) for life. It depends on how much (or how little) melanin pigment develops in the iris of the eye.
There are many variable genes that determine how much melanin develops in the iris of the eye, from very little pigment (giving blue or light-colored eyes) to a lot (giving brown or dark eyes), so it’s not always possible to accurately predict what the eye-color of the child will have from the eye-color of the parents. Nevertheless, it’s possible to make a reasonable guess, based on common variants of the two genes that most often affect eye-color. (These variable genes are OCA2 and HERC2, located right next to each other in chromosome number 15). We can call “b” the combined variants of these two genes that usually give low pigment levels in the iris, and “B” the combined variants of these two genes that usually give high pigment levels in the iris. Everyone carries a double dose of these variants, one from Mother and one from Father. Family studies show that individuals carrying b+b usually have light eyes, B+B dark eyes, and B+b also dark eyes. Apparently just one copy of “B” results in enough pigment to give dark eyes.
From the available information, Milena’s family pedigree looks like this:
Here’s the logic: (1) Because she has blue eyes, Milena’s mother is carrying b+b, and will have produced only eggs with “b”; therefore Milena must be carrying “b” from her mother. (2) Because Milena has dark eyes, she must have received “B” from her father. (3) Therefore Milena is carrying B+b; from Milena, her unborn child could have received either “B” or “b” with equal probability. (4) With his dark eyes, Milena’s husband is carrying either B+B or B+b. Which is it? – we don’t know, but we do know that in the general region of Bulgaria (where you’re from does make a difference) the “b” combination-gene-variants occur at a frequency of about 0.40 (40%); from this we can estimate that the chances of his carrying B+b (the only way his child could end up carrying b+b) is about 0.48 (48%, close enough to 50%, or ½, for the calculation). (5) The probability of Milena’s producing an egg that carries “b” is ½; if Milena’s husband also carries B+b, the probability of his producing a sperm that carries “b” is also ½; but there’s only about a 50% (½) chance that he carries B+b rather than B+B. (6) From these numbers, it can be calculated that the likelihood of Milena’s baby growing up to have blue eyes is ½ x ½ x ½ = 1/8, or about 12%.
There is the possibility that some other genes we haven’t taken account of might be inherited along with the two copies of “b” from Milena and her husband. These other genes might, for example, give their child dark eyes in spite of carrying b+b, or light eyes in spite of carrying a “B.” So the 12% is only a rough estimate, based on the most likely pattern of inheritance.
December 4, 2018. Thanks to Milena Barakova-Andonov for the question.
14. Before the baby is born, how can you tell what its sex will be? – Answer: Many pregnant women want to know the sex of their baby in advance to help plan for the baby’s arrival or just out of curiosity. There are three ways to find out: (1) anatomically, by ultrasound; (2) by looking at the chromosomes in cells obtained from the fetus; and (3) by analyzing bits of fetal DNA that are floating around in the mother’s bloodstream.
(1) Ultrasound: When the fetus has a gestational age of at least 13 weeks (that is, since the last menstrual period, at the end of 1st trimester or the beginning of 2nd trimester), the fetus has developed enough for the sex to be determined with 99% accuracy in an ultrasound image. This is the least invasive method, and the answer can be obtained almost immediately; it’s less accurate, or even completely inconclusive, when carried out much before 13 weeks.
(2) Fetal cells: The developing fetus is surrounded by a thin tissue membrane called the amnion, which is derived from the early embryo. The fetus floats in the amniotic fluid, which also contains a few floating amniotic cells. (The fetus and the amnion both originally came from the same fertilized egg, so their cells are genetically the same.) After about 14 or 15 weeks of gestation there is usually enough amniotic fluid for it to be drawn by needle and syringe (the procedure is called “amniocentesis” and usually guided by an ultrasound image for safety). The amniotic cells can be examined under a microscope to see what kind of sex chromosomes they have, whether two X’s (girl) or an X and a Y (boy)—(see questions #1 and #4 on this page).
Fetal cells can also be obtained from the chorion (the fetal side of the placenta) by what is called “chorionic villus sampling (CVS).” These chorion cells can be obtained at about the same gestational age as amniotic cells, or sometimes a little earlier.
Because amniocentesis and CVS are invasive procedures, there is a small risk of damage to the fetus, usually less than 1%.
(3) Fetal DNA in mother’s blood. When a woman is pregnant, a small amount of embryonic or fetal DNA coming from the implanted embryo is circulating in her bloodstream as early as 5-6 weeks of pregnancy. Sensitive tests can detect whether there are any Y-chromosome DNA sequences present in that DNA. If there are, it’s a boy; if not, it’s a girl.
24.vi.19
15. How many of a mother's genes are passed on to her children?
Answer: The genes she would probably be interested in would not be the genes that are normally the same for everybody -- the genes that make a human being, or the genes that underlie basic biochemical functions -- but the genes that contribute to making her an individual, the ones that give her distinctive traits, which might be passed on to her children and her grandchildren.
Like all human beings, a mother carries a double set of genes, one set she received from her mother and another set she received from her father. (Terminological note: the “genes” we are talking about here are technically called “alleles”; that is, particular forms of genes, which may be different from person to person.) Once she, as a newly fertilized egg, receives those two sets of genes, the genes are now all hers, cooperating and interacting with one another, helping to make her who she is. Let’s use the first eight letters of the alphabet to stand for those genes: ABCDEFGH. When she prepares to have her first child, a special kind of division (meiosis) begins in her ovary and eventually produces a mature egg carrying only half her genes—ACEH, say—so that her child will end up with the genes AxCxExHx. (The “x” stands for the father’s genetic contribution to the child; that’s not the concern here.) The mother will have passed on 1/2 of her genes to her child.
If she has a second child, she will start over and make another egg, again carrying half her genes, but probably not the same set of genes as the first egg had. (Given the random sorting of genes that occurs during meiosis, that would be even more unlikely than being dealt exactly the same poker hand twice in a row). The egg might carry, say, ABFH. Her second child would then be AxBxFxHx—again with half her genes, but not the same half as the first time around. So between her two children she will now have 3/4 of her genes represented (ABC-EF-H)—some in duplicate, some missing. The random nature of the process by which half the mother’s genes end up in one egg after another means that if she then has a third child, among her three children will be found, on average, 7/8 of her genes; with a fourth child, 15/16 of her genes; and so on.
The more children she has, the larger the fraction of her genes will be found in all her brood collectively. I once had a woman in class who, when we got on to the subject of twins, said, “Twins! I just love twins! I have eight children and I’m just going to keep going until I get me some twins!” With eight children already, she had about 99.6% of her genes distributed here and there among her many offspring.
Of course, whatever traits of hers do appear in her children (rather than being modified beyond recognition by the father’s set of genes), they will not be concentrated in any one child, but distributed randomly among all her children.
19.ix.21