1. How can geneticists manipulate a gene when it is so small, well beyond the reach of microscopes? . . . and then, for gene therapy, say, put the gene back into a person? –

   Answer: What gets manipulated is not exactly “a gene,” but millions of copies of it. Genes, made of DNA, are extracted from a few drops of blood or almost any other body tissue. Small samples like these typically contain thousands or millions of cells, each cell containing a complete set of genes. The number of copies of a given gene, or any piece of DNA, can be further amplified in a test tube by the PCR method (polymerase chain reaction).

   With the PCR method the copying process can also be influenced so as to get copies of the gene that are slightly different in sequence from the original ones. Normal gene copies can also be chemically linked to other pieces of DNA, modifying how the gene copies will be used when they are inserted back into cells. With such huge numbers of gene copies, a certain amount of sloppiness and inefficiency in the procedures is tolerable, as long as the “successful” DNA molecules one is interested in can be selected from the mixture. There are a number of clever ways of doing this.

   Getting copies of a gene back into living cells can be accomplished in several ways. A couple of common methods are: (1) adding the DNA to a culture of cells in a flask; a few cells will absorb the DNA molecules; (2) using some chemical tricks to link up the human DNA (modified or unmodified) to the DNA of a virus (rendered harmless by genetic methods), and letting the virus infect the cells, carrying the new DNA into the cells that way.

   All the methods are inefficient, but there are ways of afterwards detecting just which cells have taken up the DNA. Those cells can be selected, and the rest discarded. The successfully modified cells can be returned to the body by direct injection, or by transfusion into the blood stream.         17.v.14

​

​

​

​

​

​

​

​

​

2. How does CRISPR gene-editing work? – Answer: Gene editing by means of CRISPR is a recent development in DNA technology that allows a specific gene (or a specified set of genes) to be removed, replaced, or modified. “CRISPR” stands for Clustered Regularly Interspaced Short Palindromic Repeats: a technical description of a segment of bacterial DNA that bacteria use to cut the DNA of invading viruses (yes, viruses attack bacteria too). Geneticists have borrowed this system from the bacteria, along with its associated enzyme, and modified it for use in cutting and editing the DNA not just of viruses but of any gene, anywhere.

   The essence of the CRISPR system (called “CRISPR/Cas9) is a molecular complex consisting of two parts:

 

   One part is a small nucleic acid molecule called the “guide RNA.” The guide RNA binds to a short region of a gene’s DNA sequence. In the part of a gene shown below (with its particular sequence of DNA bases, A, T, G, and C), the guide RNA binds to, for example, the underlined section:

…GATCGCTGCAAAATGCAACTTGAAGATGTATGGCTTACGGTTCAGTTCTTTGA…

 

    The other part is the associated enzyme molecule (Cas9, CRISPR-associated enzyme 9), which cuts the DNA within that sequence like a pair of scissors cutting a piece of yarn; for example, at the “ / ”:

…GATCGCTGCAAAATGCAACTTGAAGATG/TATGGCTTACGGTTCAGTTCTTTGA…

 

   In short, (1) the specific guide-RNA finds a specific gene sequence, and (2) the enzyme cuts it there.

   Once the CRISPR/Cas molecular complex gets into a cell and does its work, the cell’s normal DNA-repair processes take over. The cell may splice the broken ends of the DNA back together, although often imperfectly, with some DNA bases added to or deleted from the site of the break, resulting in a non-functional gene. If an alternate, new DNA sequence has also been introduced into the cell by the scientist, the original DNA sequence may be replaced by the new DNA sequence, resulting in an “edited” gene having the new DNA sequence. For example, if the G on the left side of the break above is a disease-causing mutation (a faulty genetic code), the new DNA sequence that replaces it might have the correct A. The CRISPR/Cas9 complex would have corrected the G to an A, and the gene would have been “edited,” or repaired as shown below:

…GATCGCTGCAAAATGCAACTTGAAGATATATGGCTTACGGTTCAGTTCTTTGA…

 

   Older methods of introducing alternate forms of genes into cells were relatively laborious and time-consuming. They were also often hit-or-miss; one never knew exactly where the new DNA sequence was going to end up. The CRISPR method, by contrast, is relatively easy, fast, and precise; the guide-RNA can be tailor-made to bind any given sequence, in any chosen gene out of the approximately 20,000 genes that human cells possess.

   The main current limitations of the CRISPR method in its broad application to human gene-editing are that (1) it’s not always easy to get the CRISPR/Cas complex into just the kind of cells you want, such as brain cells or fetal cells; and (2) some genes have similar sequences, so that sometimes, along with the gene you’re aiming at, another gene gets changed, with unintended consequences.

   Nevertheless, certain genes that contain disease-causing mutations may, before long, be able to be routinely repaired by the CRISPR method. These include repairs of the mutated genes that cause muscular dystrophy, sickle-cell anemia, thalassemia, hemophilia, Huntington’s disease, cystic fibrosis and other diseases caused by single-gene defects. Cells of the immune system may also be genetically edited, inducing them to attack cancer cells. The method could be used to edit out Human-Immunodeficiency-Virus (HIV) sequences from infected cells.

   However, genetic alterations of genes underlying more complex traits, such as musical ability, or personality characteristics (courage, optimism, conscientiousness), or intelligence (measured as an IQ score), which depend on complicated interactions of hundreds of different genes as well as interactions with the environment, seem unlikely to give satisfactory results anytime in the near future, or even the far future.

6.v.21

​

​

​

​

​

​

​

3. Are genetically modified mosquitoes safe and effective for mosquito control?

Answer: Yes, if the genetic modification is done right. Here are the facts about genetically modified Aedes aegypti. The wild mosquito species Aedes aegypti occurs throughout the tropical and subtropical regions of the world, and is a carrier of several viruses that can cause grave diseases in people: yellow fever, West Nile disease, dengue fever, chikungunya, and encephalitis. In some areas this mosquito carries the Zika virus, infections of which can cause serious fetal brain malformation. One way to lower the frequency of these diseases is to kill off mosquitoes that might be carrying the viruses. (Besides, for many of these viruses, there are currently no effective vaccines.)

   Aedes mosquitoes have been genetically engineered in the laboratory. When males of the genetically modified strain (“GM mosquitoes”) are released, they mate with wild female mosquitoes, and all the offspring die.

   A special piece of DNA, amounting to about 1/100,000th of the mosquito’s own DNA, was micro-injected into individual mosquito eggs. The mosquito larvae in which the procedure was successful were selected, raised to adulthood, and then mated with one another to produce large numbers of GM mosquitoes.

   The inserted piece of DNA contains a “lethal gene” which when “on” interferes with the mosquito’s own genes, and the mosquito dies before becoming an adult. The inserted piece of DNA also contains another sequence of DNA making it sensitive to tetracycline, a common antibiotic. With tetracycline in the mosquito larvae’s food, the lethal gene is turned “off,” and the GM mosquitoes can be raised in the laboratory generation after generation. But when GM males are released into the wild, where there is no tetracycline, and mate with wild females, all their offspring die. (You’re not likely to see mosquito larvae coming out of their puddles and wriggling up to the pharmacist’s counter to have their tetracycline prescriptions filled!) Local decreases in the numbers of Aedes aegypti should reduce the chances of being bitten.

 

   Is the method effective? Yes. In tests begun in 2010, and continuing, releases of millions of male GM mosquitoes into local neighborhoods in Brazil, Panama, and the Cayman Islands have, over a period of a few months, successfully reduced local wild Aedes aegypti populations to less than 10% of their original numbers. The release of male GM mosquitoes is more effective than other methods, such as trapping mosquitoes or spraying neighborhoods with insecticides. (In some places, the GM mosquito has been called “the friendly mosquito” by the locals.) Actual reduction in some of the viral diseases caused by mosquito bites is beginning to be seen, but more longer-term studies are still needed.

   Is the method safe? Yes, both for people and for the environment. Male mosquitoes don’t bite, so the GM mosquitoes released into the wild would have no effect on people. And all the GM larvae produced in the wild, male and female, die before becoming adults, so the special DNA they carry has virtually no chance of coming in contact with people. Even if a female GM mosquito escapes or is inadvertently released from a laboratory, its bite does not transmit any mosquito genes or any harmful molecules it may contain as a result of being genetically engineered – so there would not be any consequences to people by that route.

   The GM-mosquito releases appear not to have any environmental consequences that scientists can detect. The decreases in wild mosquito populations occur only locally, and increases in other mosquito species as a result has not been observed. (The effect of deleting Aedes aegypti from the menus of the dragonflies, small fish, and small birds that sometimes eat them is like having your local McDonald’s close down – you just drive to the next McDonald’s, or go to Burger King.) In the tests that have been carried out so far, there are no noticeable effects on other animals of eating GM mosquitoes – this is what would be expected, because animals that eat GM mosquitoes digest all the mosquito’s DNA molecules.

 

   Each different application of a genetically modified organism needs to be judged for its own potential dangers and its own potential merits. In the case of this GM mosquito, after some years of testing, there appear to be no downsides – no detectable dangers to either people or the environment – and the program has the potential benefit of reducing the levels of some miserable viral diseases. The release of GM mosquitoes into local environments thus falls in the same category as other disease-reducing methods, such as adding disinfectants to water supplies, or recommending antibiotics and vaccinations against common diseases.

 

26 September 2016, revised 3 November 2016

​

​

​